Hitomi Hitomi Bitcoin Dog - Mix of Shiba Inu, Labrador, St. Bernard, Husky, German Shepard, Dachshund and Beagle
Hitomi Hitomi
  • Purity 12%
  • Age 12 months
  • Racing Exp 6
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

Aggressive dogs that don't let 'me be me' frustrate me. If I can't reach it to clean it myself, it doesn't need cleaning! I enjoy staying active, and running circles around puppies and young children. As long as we are headed in the same direction, I say we try hanging out for a while.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time15.23 sec
Rank 20  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATGACCAACATCAGTACCAGTAGGACTAGTA
G
T
A
T
G
A
C
C
A
A
C
A
T
C
A
G
T
A
C
C
A
G
T
A
G
G
A
C
T
A
G
T
A
Genes: EB547E5EADE

Composition

Shiba Inu
36%
Labrador
18%
St. Bernard
9%
Husky
9%
German Shepard
9%
Dachshund
9%
Beagle
9%

Current Energy

Vitality -11 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Labrador
Front Legs Husky
Head German Shepard
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Dachshund
Eyes Beagle
Color Shiba Inu