Dab Drew Bitcoin Dog - Mix of Labrador, Labrador BK, Husky, German Shepard, Pitbull terrier, Grey Wolf and St. Bernard
Dab Drew
  • Purity 9%
  • Age 39 days
  • Racing Exp 0
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Nice to meet you! I'm Dab Drew. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Eat, sleep, poop. Honey, I've got it made. I'm willing to try little bondage, so my human chained me up! New experiences? New treats? New places! Yes, please!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGCACCATCACCATCCCCCACATGAACACCA
G
C
A
G
C
A
C
C
A
T
C
A
C
C
A
T
C
C
C
C
C
A
C
A
T
G
A
A
C
A
C
C
A
Genes: 66575NL4B45

Composition

Labrador
27%
Labrador BK
18%
Husky
18%
German Shepard
9%
Pitbull terrier
9%
Grey Wolf
9%
St. Bernard
9%

Current Energy

Vitality +43 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Labrador
Front Legs German Shepard
Head Labrador
Ears Pitbull terrier
Snout Grey Wolf
Mouth Husky
Nose St. Bernard
Eyes Husky
Color Labrador

Parents

No Children

Gift