Abbot Angel Bitcoin Game Dog - Mix of Beagle, Labrador, Schnauzer, Pug, Corgi, Rottweiler, Labrador BK, Grey Wolf, St. Bernard and Boxer
Abbot Angel
  • Purity 1%
  • Age 6 months
  • Racing Exp 1
  • Beagle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

They call me Abbot Angel. What's your name? Don't bother contacting me if you like cats. Size doesn't matter, I like 'em all. Sometimes I just have to roll in something dead. My favorite position is doggie style ;)

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time18.03 sec
Rank 80  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTACCACTAATAGAAAGCCACGCACCCTGAAAC
C
T
A
C
C
A
C
T
A
A
T
A
G
A
A
A
G
C
C
A
C
G
C
A
C
C
C
T
G
A
A
A
C
Genes: D5DC2OH6LBG

Composition

Beagle
18%
Labrador
9%
Schnauzer
9%
Pug
9%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Grey Wolf
9%
St. Bernard
9%
Boxer
9%

Current Energy

Vitality -60 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs Beagle
Front Legs Schnauzer
Head Pug
Ears Corgi
Snout Rottweiler
Mouth Labrador BK
Nose Grey Wolf
Eyes St. Bernard
Color Boxer

Parents

No Children

Photos

Gift