Nibby-Nose Nana Cryptocurrency Dog - Mix of Yorkshire Terrier, Corgi, Shiba Inu, Maltese, Poodle, Boxer and Pitbull terrier
Nibby-Nose Nana
  • Purity 11%
  • Age 4 months
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Happy & Agile

Achievements

None

Bio

Hi! My name is Nibby-Nose Nana. Removing excess stuffing from pillows is my favorite hobby. I'll outrun you for the ball if I can...that's just how I roll. I really dislike stinky flea collars. I'm looking for someone who is also playful, feisty and happy.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTAGTAAGCACCTTAGACAGCAACAGCTCCTTA
T
T
A
G
T
A
A
G
C
A
C
C
T
T
A
G
A
C
A
G
C
A
A
C
A
G
C
T
C
C
T
T
A
Genes: FEOKFIOGONF

Composition

Yorkshire Terrier
27%
Corgi
27%
Shiba Inu
9%
Maltese
9%
Poodle
9%
Boxer
9%
Pitbull terrier
9%

Current Energy

Vitality -60 points
Lunar Effect -4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Shiba Inu
Legs Corgi
Front Legs Maltese
Head Yorkshire Terrier
Ears Poodle
Snout Corgi
Mouth Boxer
Nose Corgi
Eyes Pitbull terrier
Color Yorkshire Terrier