Puddles Pablo Litecoin Dog - Mix of Husky, Pug, Shiba Inu, Labrador, Poodle and Dachshund
Puddles Pablo
  • Purity 15%
  • Age 3 months
  • Racing Exp 0
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Agile

Achievements

None

Bio

Top o' the mornin' to ya! I'm Puddles Pablo. I'm a super-dog in the internet universe. My human's feet are definitely the greatest smell ever. Especially after a long day at work! If you have fleas or ticks, don't bother. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAGTAACACCAACAACAGACGAAGGAGAAACA
G
A
A
G
T
A
A
C
A
C
C
A
A
C
A
A
C
A
G
A
C
G
A
A
G
G
A
G
A
A
A
C
A
Genes: 2E4544I2A24

Composition

Husky
36%
Pug
27%
Shiba Inu
9%
Labrador
9%
Poodle
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Husky
Front Legs Labrador
Head Husky
Ears Husky
Snout Poodle
Mouth Pug
Nose Dachshund
Eyes Pug
Color Husky