Audrey Archie Virtual Crypto Game Dog - Mix of Shiba Inu, St. Bernard, Rottweiler, Golder Retriever, Maltese, Yorkshire Terrier, German Shepard and Corgi
Audrey Archie
  • Purity 6%
  • Age 25 days
  • Racing Exp 0
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Tardy

Achievements

None

Bio

I'd like to help you shed your coat, baby. I have a crush on the Grumpy cat. I hate it when other dogs pee in my yard! IT'S MY YARD!! Squeaky toys are the best, don't you agree? I'm looking for someone who is also playful, feisty and happy.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATGACACAGATGAACCTTATCACACAGCGTA
G
T
A
T
G
A
C
A
C
A
G
A
T
G
A
A
C
C
T
T
A
T
C
A
C
A
C
A
G
C
G
T
A
Genes: EBH8BKF7HOE

Composition

Shiba Inu
18%
St. Bernard
18%
Rottweiler
18%
Golder Retriever
9%
Maltese
9%
Yorkshire Terrier
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality +28 points
Lunar Effect +8 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Rottweiler
Front Legs Golder Retriever
Head St. Bernard
Ears Maltese
Snout Yorkshire Terrier
Mouth German Shepard
Nose Rottweiler
Eyes Corgi
Color Shiba Inu