Mary Puppins Mystique Digital Cryptocurrency Dog - Mix of Pug, Shiba Inu, Boxer, Yorkshire Terrier, Pitbull terrier, Maltese and Schnauzer
Mary Puppins Mystique
  • Purity 10%
  • Age 3 months
  • Racing Exp 0
  • Pug 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Happy & Fast

Achievements

None

Bio

A-yo...Call me Mary Puppins Mystique. My favorite treat is to steal the pepperoni off of pizza. I'm not into dog collars, unless you're into S & M. I love barking all night when others try to sleep. I have a crush on the Grumpy cat.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAGTAGAAGTAAACGAATTATCCACCGAAATA
G
A
A
G
T
A
G
A
A
G
T
A
A
A
C
G
A
A
T
T
A
T
C
C
A
C
C
G
A
A
A
T
A
Genes: 2E2EG2FNK2C

Composition

Pug
36%
Shiba Inu
18%
Boxer
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality -46 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Pug
Front Legs Shiba Inu
Head Boxer
Ears Pug
Snout Yorkshire Terrier
Mouth Pitbull terrier
Nose Maltese
Eyes Pug
Color Schnauzer