Pretty Paco Bitcoin Game Dog - Mix of German Shepard, Husky, Boxer, St. Bernard and Labrador
Pretty Paco
  • Purity 29%
  • Age 26 days
  • Racing Exp 0
  • German Shepard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 13
Sad & Tardy

Achievements

None

Bio

Ima cyber dog. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I adore sleeping upside down with my tongue hanging out! Long or short hair works for me, just no baldies please. Air Bud is definitely my favorite movie. What a role model!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAAACTCATCATGACCAACATCATCATCAACA
T
C
A
A
A
C
T
C
A
T
C
A
T
G
A
C
C
A
A
C
A
T
C
A
T
C
A
T
C
A
A
C
A
Genes: 7G77B547774

Composition

German Shepard
55%
Husky
18%
Boxer
9%
St. Bernard
9%
Labrador
9%

Current Energy

Vitality +48 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs German Shepard
Front Legs German Shepard
Head St. Bernard
Ears Labrador
Snout Husky
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Husky