Saber Spud Crypto Dog - Mix of Husky, Labrador BK, Rottweiler, Border Collie, Grey Wolf, German Shepard, Pitbull terrier and Golder Retriever
Saber Spud
  • Purity 11%
  • Age 27 days
  • Racing Exp 0
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 7
Sad & Tardy

Achievements

None

Bio

Howdy potential partner! Saber Spud here. In my digital world, cats aren't the only ones who hack. I love cuddling up, doggy-style after a romantic evening. I live life by my favorite quote "Every dog has it's day", but every day is my day! My female human wears crotchless undies, but she doesn't like the ones I make for her!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACACACATACCCCTCAACATCCAGAACAACA
G
C
A
C
A
C
A
C
A
T
A
C
C
C
C
T
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 6H4JL74N844

Composition

Husky
36%
Labrador BK
9%
Rottweiler
9%
Border Collie
9%
Grey Wolf
9%
German Shepard
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality +48 points
Lunar Effect +12 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Border Collie
Head Grey Wolf
Ears German Shepard
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky