Blake Bongo Bitcoin Dog - Mix of Grey Wolf, Beagle, Pitbull terrier, Shiba Inu, Labrador BK and Maltese
Blake Bongo
  • Purity 18%
  • Age 28 days
  • Racing Exp 0
  • Grey Wolf 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Tardy

Achievements

None

Bio

I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I'll lick anything. If you enjoy growling through fences as much as I do, we should get together.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATCCCTACCCGTACCCGCACCCCCCACCCCC
C
T
A
T
C
C
C
T
A
C
C
C
G
T
A
C
C
C
G
C
A
C
C
C
C
C
C
A
C
C
C
C
C
Genes: DNDLEL6LLKL

Composition

Grey Wolf
45%
Beagle
18%
Pitbull terrier
9%
Shiba Inu
9%
Labrador BK
9%
Maltese
9%

Current Energy

Vitality +16 points
Lunar Effect +20 points

Traits Breakdown

Body Beagle
Tail Pitbull terrier
Legs Beagle
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Labrador BK
Mouth Grey Wolf
Nose Grey Wolf
Eyes Maltese
Color Grey Wolf