Bessie Betsy Crypto Dog - Mix of Grey Wolf, Husky, Pitbull terrier, Rottweiler, Shiba Inu and Border Collie
Bessie Betsy
  • Purity 21%
  • Age 28 days
  • Racing Exp 0
  • Grey Wolf 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Sad & Tardy

Achievements

None

Bio

Yo! I'm Bessie Betsy and I'd like to rock your world. I've always wanted to be in commercials and be treated as the star I am! My favorite way to spend playtime is a good game of frisbee. I don't like having to stay off the furniture. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCCACCCCCCCGTAACACCCCCCCCCTACACA
T
C
C
C
A
C
C
C
C
C
C
C
G
T
A
A
C
A
C
C
C
C
C
C
C
C
C
T
A
C
A
C
A
Genes: NHLLE4LLLJ4

Composition

Grey Wolf
45%
Husky
18%
Pitbull terrier
9%
Rottweiler
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality +54 points
Lunar Effect +24 points

Traits Breakdown

Body Pitbull terrier
Tail Rottweiler
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Husky
Snout Grey Wolf
Mouth Grey Wolf
Nose Grey Wolf
Eyes Border Collie
Color Husky