Domino Dinky Cryptocurrency Dog - Mix of Grey Wolf, Husky, Border Collie, Rottweiler and Dachshund
Domino Dinky
  • Purity 15%
  • Age 6 months
  • Racing Exp 0
  • Grey Wolf 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Tardy

Achievements

None

Bio

Good day to you! I'm Domino Dinky! Ima cyber dog. Fences are just challenges...I don't let them stop me! It doesn't matter to me which team I play for... I just like tail. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCCACACAGGACCCACACCCTACCCCTACACA
C
C
C
C
A
C
A
C
A
G
G
A
C
C
C
A
C
A
C
C
C
T
A
C
C
C
C
T
A
C
A
C
A
Genes: LH4AL4LJLJ4

Composition

Grey Wolf
36%
Husky
27%
Border Collie
18%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -13 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Husky
Front Legs Dachshund
Head Grey Wolf
Ears Husky
Snout Grey Wolf
Mouth Border Collie
Nose Grey Wolf
Eyes Border Collie
Color Husky