Nitro Napoleon Bitcoin Game Dog - Mix of Pug, Schnauzer, Pitbull terrier, Grey Wolf, Labrador BK, German Shepard, French Bulldog and Dachshund
Nitro Napoleon
  • Purity 8%
  • Age 6 months
  • Racing Exp 13
  • Pug 27%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I'm having some new data architecture built for me, then I'd like to have you over to my place. If you have fleas or ticks, don't bother. It turns me on when I can show an older dog a new trick. My favorite game is Fetch except I never bring the ball back.

Racing Stats

Ran 2 races
  • 0 1 1
 Best Time15.70 sec
No rank  RacingĀ *** LTC
100.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCGAACCCATAGCAATAGAAGAATCACGAGGA
T
C
C
G
A
A
C
C
C
A
T
A
G
C
A
A
T
A
G
A
A
G
A
A
T
C
A
C
G
A
G
G
A
Genes: N2LC6C2279A

Composition

Pug
27%
Schnauzer
18%
Pitbull terrier
9%
Grey Wolf
9%
Labrador BK
9%
German Shepard
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -40 points
Lunar Effect +2 points

Traits Breakdown

Body Pitbull terrier
Tail Pug
Legs Grey Wolf
Front Legs Schnauzer
Head Labrador BK
Ears Schnauzer
Snout Pug
Mouth Pug
Nose German Shepard
Eyes French Bulldog
Color Dachshund