Ricky Bobby Rouge The Bat Digital Cryptocurrency Dog - Mix of Grey Wolf, Beagle, Pitbull terrier, St. Bernard, Shiba Inu, Labrador BK and Maltese
Ricky Bobby Rouge The Bat
  • Purity 16%
  • Age 29 days
  • Racing Exp 0
  • Grey Wolf 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Sad & Tardy

Achievements

None

Bio

I'm a serial monogamist. I love connecting with my friends via pee-mail. Air Bud is definitely my favorite movie. What a role model! I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATCCCCCTGAGTACCCGCACCCCCCACCCCC
C
T
A
T
C
C
C
C
C
T
G
A
G
T
A
C
C
C
G
C
A
C
C
C
C
C
C
A
C
C
C
C
C
Genes: DNLBEL6LLKL

Composition

Grey Wolf
45%
Beagle
9%
Pitbull terrier
9%
St. Bernard
9%
Shiba Inu
9%
Labrador BK
9%
Maltese
9%

Current Energy

Vitality +21 points
Lunar Effect +20 points

Traits Breakdown

Body Beagle
Tail Pitbull terrier
Legs Grey Wolf
Front Legs St. Bernard
Head Shiba Inu
Ears Grey Wolf
Snout Labrador BK
Mouth Grey Wolf
Nose Grey Wolf
Eyes Maltese
Color Grey Wolf