Butternut Boo Cryptocurrency Dog - Mix of Grey Wolf, Pitbull terrier, Maltese, Shiba Inu and Labrador BK
Butternut Boo
  • Purity 20%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Happy & Fast

Achievements

None

Bio

I live in cyberspace. I hate having to wear foo-foo clothes and ribbons in my fur. I adore sleeping upside down with my tongue hanging out! My favorite place to sleep is under the covers between my humans. I'm looking for someone to share my collection of artisan rawhide with!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCTCCCCCCCCGTACCCGCACCCTCCACCACC
T
C
C
T
C
C
C
C
C
C
C
C
G
T
A
C
C
C
G
C
A
C
C
C
T
C
C
A
C
C
A
C
C
Genes: NNLLEL6LNKK

Composition

Grey Wolf
36%
Pitbull terrier
27%
Maltese
18%
Shiba Inu
9%
Labrador BK
9%

Current Energy

Vitality -19 points
Lunar Effect -14 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Labrador BK
Mouth Grey Wolf
Nose Pitbull terrier
Eyes Maltese
Color Maltese