Olivia Offense Litecoin Dog - Mix of Pitbull terrier, Rottweiler, Shiba Inu, St. Bernard, Schnauzer and Boxer
Olivia Offense
  • Purity 20%
  • Age 5 months
  • Racing Exp 0
  • Pitbull terrier 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Casual

Achievements

None

Bio

Hey there! Baby, call me Olivia Offense. I'm a super-dog in the internet universe. I love connecting with my friends via pee-mail. My female human wears crotchless undies, but she doesn't like the ones I make for her! I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATCCTCCTCCTGATCCCACTCCATAAACCAC
G
T
A
T
C
C
T
C
C
T
C
C
T
G
A
T
C
C
C
A
C
T
C
C
A
T
A
A
A
C
C
A
C
Genes: ENNNBNHNCGH

Composition

Pitbull terrier
45%
Rottweiler
18%
Shiba Inu
9%
St. Bernard
9%
Schnauzer
9%
Boxer
9%

Current Energy

Vitality -45 points
Lunar Effect +8 points

Traits Breakdown

Body Shiba Inu
Tail Pitbull terrier
Legs Pitbull terrier
Front Legs Pitbull terrier
Head St. Bernard
Ears Pitbull terrier
Snout Rottweiler
Mouth Pitbull terrier
Nose Schnauzer
Eyes Boxer
Color Rottweiler