Longo Doggo Legolas Litecoin Game Dog - Mix of Grey Wolf, Dachshund, Border Collie, German Shepard, Beagle, French Bulldog and Pitbull terrier
Longo Doggo Legolas
  • Purity 9%
  • Age 14 months
  • Racing Exp 0
  • Grey Wolf 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

How you doin? ;) Longo Doggo Legolas here. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I love connecting with my friends via pee-mail. I need to find someone tuff to help me protect our pups from that scheming mailman!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCTCACTAGGAGGACGACCCTACCCCTACTCC
C
C
C
T
C
A
C
T
A
G
G
A
G
G
A
C
G
A
C
C
C
T
A
C
C
C
C
T
A
C
T
C
C
Genes: L7DAA9LJLJN

Composition

Grey Wolf
27%
Dachshund
18%
Border Collie
18%
German Shepard
9%
Beagle
9%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality -39 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Beagle
Front Legs Dachshund
Head Dachshund
Ears French Bulldog
Snout Grey Wolf
Mouth Border Collie
Nose Grey Wolf
Eyes Border Collie
Color Pitbull terrier