Carrera Chandler Litecoin Dog - Mix of Shiba Inu, Labrador, Grey Wolf and Schnauzer
Carrera Chandler
  • Purity 35%
  • Age 5 months
  • Racing Exp 0
  • Shiba Inu 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Casual

Achievements

None

Bio

Ima Ethernet dog. I've been known to run with bad dogs. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCACCCGTAGTAGTAGTAGTAATACCACCAGTA
C
C
A
C
C
C
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
A
T
A
C
C
A
C
C
A
G
T
A
Genes: 5LEEEEEC55E

Composition

Shiba Inu
55%
Labrador
27%
Grey Wolf
9%
Schnauzer
9%

Current Energy

Vitality -26 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Grey Wolf
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Schnauzer
Nose Labrador
Eyes Labrador
Color Shiba Inu