Hamlet Higgins Bitcoin Dog - Mix of Shiba Inu, Labrador BK, German Shepard, Schnauzer, Grey Wolf and Yorkshire Terrier
Hamlet Higgins
  • Purity 11%
  • Age 5 months
  • Racing Exp 0
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Casual

Achievements

None

Bio

My name is Hamlet Higgins and I do tricks. Dragging my butt on the carpet feels so good. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACCCGCATCAGTAGTATCAATAGTATTAATA
G
C
A
C
C
C
G
C
A
T
C
A
G
T
A
G
T
A
T
C
A
A
T
A
G
T
A
T
T
A
A
T
A
Genes: 6L67EE7CEFC

Composition

Shiba Inu
27%
Labrador BK
18%
German Shepard
18%
Schnauzer
18%
Grey Wolf
9%
Yorkshire Terrier
9%

Current Energy

Vitality -1 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador BK
Tail Grey Wolf
Legs Labrador BK
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout German Shepard
Mouth Schnauzer
Nose Shiba Inu
Eyes Yorkshire Terrier
Color Schnauzer