Chivas Cliff Crypto Dog - Mix of Dachshund, Rottweiler, Border Collie, German Shepard, French Bulldog, Grey Wolf and Corgi
Chivas Cliff
  • Purity 12%
  • Age 4 months
  • Racing Exp 0
  • Dachshund 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Slothful

Achievements

None

Bio

I answer to 'Chivas Cliff'. As a perfectionist, I have to find just the right 'spot'. I'm into group dog piles, the more the better. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I just want to "share a bone"... ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTCACACCGACCCGGAAGCGGAGGACACGGA
T
A
C
T
C
A
C
A
C
C
G
A
C
C
C
G
G
A
A
G
C
G
G
A
G
G
A
C
A
C
G
G
A
Genes: J7H9LAOAAHA

Composition

Dachshund
36%
Rottweiler
18%
Border Collie
9%
German Shepard
9%
French Bulldog
9%
Grey Wolf
9%
Corgi
9%

Current Energy

Vitality -29 points
Lunar Effect -18 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Rottweiler
Front Legs French Bulldog
Head Grey Wolf
Ears Dachshund
Snout Corgi
Mouth Dachshund
Nose Dachshund
Eyes Rottweiler
Color Dachshund