Angelina Augie Crypto Dog - Mix of French Bulldog, Golder Retriever, Border Collie, Maltese, Husky, Labrador, Schnauzer and Shiba Inu
Angelina Augie
  • Purity 4%
  • Age 5 months
  • Racing Exp 1
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hey there! Baby, call me Angelina Augie. I live in your digital dreams. My favorite position is doggie style ;) Once I caught a seagull, but it scared me so I let it go. I hate it when humans put the lid down. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm not that picky. Wanna mate?

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.25 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAACCAGAACACGAAGACCATACATAGTATAC
C
G
A
A
C
C
A
G
A
A
C
A
C
G
A
A
G
A
C
C
A
T
A
C
A
T
A
G
T
A
T
A
C
Genes: 9K84985JCEJ

Composition

French Bulldog
18%
Golder Retriever
18%
Border Collie
18%
Maltese
9%
Husky
9%
Labrador
9%
Schnauzer
9%
Shiba Inu
9%

Current Energy

Vitality -27 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs Golder Retriever
Front Legs Husky
Head French Bulldog
Ears Golder Retriever
Snout Labrador
Mouth Border Collie
Nose Schnauzer
Eyes Shiba Inu
Color Border Collie

Parents

No Children

Photos

Gift