Eloise Evil Empire Litecoin Dog - Mix of Labrador, Labrador BK, Rottweiler, St. Bernard, Husky, Dachshund and Pitbull terrier
Eloise Evil Empire
  • Purity 7%
  • Age 6 months
  • Racing Exp 0
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

Hullo. My name is Eloise Evil Empire. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I'll lick anything. Rolling around on the carpet after a bath is my favorite way to dry.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCATGACCAACACACGGAGCATCCCCACACCCA
G
C
A
T
G
A
C
C
A
A
C
A
C
A
C
G
G
A
G
C
A
T
C
C
C
C
A
C
A
C
C
C
A
Genes: 6B54HA6N5H5

Composition

Labrador
27%
Labrador BK
18%
Rottweiler
18%
St. Bernard
9%
Husky
9%
Dachshund
9%
Pitbull terrier
9%

Current Energy

Vitality -4 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Labrador
Front Legs Husky
Head Rottweiler
Ears Dachshund
Snout Labrador BK
Mouth Pitbull terrier
Nose Labrador
Eyes Rottweiler
Color Labrador