Bean Bucko Digital Cryptocurrency Dog - Mix of Dachshund, Border Collie, Rottweiler, Golder Retriever, Grey Wolf, Pitbull terrier and Poodle
Bean Bucko
  • Purity 9%
  • Age 14 months
  • Racing Exp 0
  • Dachshund 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Sup? ;-) I'm Bean Bucko. My favorite thing is to sit in my humans' laps while they are trying to read or drive. Long or short hair works for me, just no baldies please. I don't understand why I like smelling butts... I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACAGACACTACCCCGGATCCGGAGGACACGAC
T
A
C
A
G
A
C
A
C
T
A
C
C
C
C
G
G
A
T
C
C
G
G
A
G
G
A
C
A
C
G
A
C
Genes: J8HJLANAAHI

Composition

Dachshund
27%
Border Collie
18%
Rottweiler
18%
Golder Retriever
9%
Grey Wolf
9%
Pitbull terrier
9%
Poodle
9%

Current Energy

Vitality -17 points
Lunar Effect -2 points

Traits Breakdown

Body Border Collie
Tail Golder Retriever
Legs Rottweiler
Front Legs Border Collie
Head Grey Wolf
Ears Dachshund
Snout Pitbull terrier
Mouth Dachshund
Nose Dachshund
Eyes Rottweiler
Color Poodle