Scooter Star Bitcoin Dog - Mix of Shiba Inu, Labrador, St. Bernard, Grey Wolf and Pitbull terrier
Scooter Star
  • Purity 18%
  • Age 14 months
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Scooter Star is the name, love is my game. And fetch of course... Ima Ethernet dog. I'll lick anything. Power outages and computer viruses scare me! Forget plastic hotdogs...I'm into the classic chew toys like slippers. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCATGAGTAGTACCCTGAGTATCCCCACCAGTA
C
C
A
T
G
A
G
T
A
G
T
A
C
C
C
T
G
A
G
T
A
T
C
C
C
C
A
C
C
A
G
T
A
Genes: 5BEELBEN55E

Composition

Shiba Inu
36%
Labrador
27%
St. Bernard
18%
Grey Wolf
9%
Pitbull terrier
9%

Current Energy

Vitality -28 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador
Tail St. Bernard
Legs Shiba Inu
Front Legs Shiba Inu
Head Grey Wolf
Ears St. Bernard
Snout Shiba Inu
Mouth Pitbull terrier
Nose Labrador
Eyes Labrador
Color Shiba Inu