Rockwell Rosa Crypto Dog - Mix of Husky, Grey Wolf, Rottweiler, Beagle, Dachshund and Border Collie
Rockwell Rosa
  • Purity 14%
  • Age 14 months
  • Racing Exp 0
  • Husky 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

I live in cyberspace where you can turn me on. If you enjoy growling through fences as much as I do, we should get together. I hate it when my human runs out of poop-bags. How embarrassing! I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
Rank 55  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACCACACACCCCCCACACCCCTAGGATACACA
C
A
C
C
A
C
A
C
A
C
C
C
C
C
C
A
C
A
C
C
C
C
T
A
G
G
A
T
A
C
A
C
A
Genes: HH4LL4LDAJ4

Composition

Husky
27%
Grey Wolf
27%
Rottweiler
18%
Beagle
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality -8 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Husky
Front Legs Grey Wolf
Head Grey Wolf
Ears Husky
Snout Grey Wolf
Mouth Beagle
Nose Dachshund
Eyes Border Collie
Color Husky