Gouken Gabriella Litecoin Game Dog - Mix of Golder Retriever, Beagle, Poodle, Pitbull terrier, Corgi, Shiba Inu and Rottweiler
Gouken Gabriella
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Happy & Quick

Achievements

None

Bio

Yo! I'm Gouken Gabriella and I'd like to rock your world. I don't like running outta pee when there are still so many trees. My human says I'm loyal, intelligent, devoted and affectionate. My favorite sport is catching treats my human throws! People food disagrees with me. Whew! You can tell.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACAGACTATCCAGAAGCGTACTACACAGAAGA
G
A
C
A
G
A
C
T
A
T
C
C
A
G
A
A
G
C
G
T
A
C
T
A
C
A
C
A
G
A
A
G
A
Genes: I8DN8OEDH88

Composition

Golder Retriever
36%
Beagle
18%
Poodle
9%
Pitbull terrier
9%
Corgi
9%
Shiba Inu
9%
Rottweiler
9%

Current Energy

Vitality -38 points
Lunar Effect -14 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs Beagle
Front Legs Pitbull terrier
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever