Tuck Tango Litecoin Dog - Mix of Husky, Rottweiler, Labrador, Yorkshire Terrier, Pug, Dachshund, Border Collie and Poodle
Tuck Tango
  • Purity 11%
  • Age 3 months
  • Racing Exp 0
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Happy & Quick

Achievements

None

Bio

I'm 100% digital, baby. People food disagrees with me. Whew! You can tell. Long or short hair works for me, just no baldies please. I love unconditionally. Hound Dog by Elvis is probably the best song ever written.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACACACACACCAACAACATTAGAAGGATACGAC
A
C
A
C
A
C
A
C
A
C
C
A
A
C
A
A
C
A
T
T
A
G
A
A
G
G
A
T
A
C
G
A
C
Genes: 4H4544F2AJI

Composition

Husky
36%
Rottweiler
9%
Labrador
9%
Yorkshire Terrier
9%
Pug
9%
Dachshund
9%
Border Collie
9%
Poodle
9%

Current Energy

Vitality -1 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Rottweiler
Legs Husky
Front Legs Labrador
Head Husky
Ears Husky
Snout Yorkshire Terrier
Mouth Pug
Nose Dachshund
Eyes Border Collie
Color Poodle