Siri Simba Litecoin Dog - Mix of Husky, Rottweiler, Labrador, Poodle, Pug, Dachshund and Border Collie
Siri Simba
  • Purity 14%
  • Age 5 months
  • Racing Exp 0
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Casual

Achievements

None

Bio

What's up, pup? Name's Siri Simba. I'm not a bad dog, my data is just configured that way. My human says I'm loyal, intelligent, devoted and affectionate. I don't like having to stay off the furniture. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
Rank 50  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACCACACACCAACAACAGACGAAGGATACACA
C
A
C
C
A
C
A
C
A
C
C
A
A
C
A
A
C
A
G
A
C
G
A
A
G
G
A
T
A
C
A
C
A
Genes: HH4544I2AJ4

Composition

Husky
36%
Rottweiler
18%
Labrador
9%
Poodle
9%
Pug
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality -6 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Husky
Front Legs Labrador
Head Husky
Ears Husky
Snout Poodle
Mouth Pug
Nose Dachshund
Eyes Border Collie
Color Husky