Cutey Honey Cliff Cryptocurrency Dog - Mix of Husky, Yorkshire Terrier, Golder Retriever, Maltese, Corgi and Poodle
Cutey Honey Cliff
  • Purity 18%
  • Age 10 days
  • Racing Exp 0
  • Husky 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Casual

Achievements

None

Bio

Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. You know the worst? Watching my humans 'get it on' when I've got no one. My favorite position is doggie style ;) I'm a serial monogamist.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAAGAACATTAACATTAACCACAAGCGAC
A
C
A
A
C
A
A
G
A
A
C
A
T
T
A
A
C
A
T
T
A
A
C
C
A
C
A
A
G
C
G
A
C
Genes: 4484F4FK4OI

Composition

Husky
45%
Yorkshire Terrier
18%
Golder Retriever
9%
Maltese
9%
Corgi
9%
Poodle
9%

Current Energy

Vitality +38 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Golder Retriever
Front Legs Husky
Head Yorkshire Terrier
Ears Husky
Snout Yorkshire Terrier
Mouth Maltese
Nose Husky
Eyes Corgi
Color Poodle