Phoebe Precious Bitcoin Game Dog - Mix of Husky, Yorkshire Terrier, Golder Retriever, Schnauzer, German Shepard and Corgi
Phoebe Precious
  • Purity 15%
  • Age 10 days
  • Racing Exp 0
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Casual

Achievements

None

Bio

Hi, Phoebe Precious is my name. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I have a crush on the Grumpy cat. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAAGAACATTAACATTAATATCAAGCTTA
A
C
A
A
C
A
A
G
A
A
C
A
T
T
A
A
C
A
T
T
A
A
T
A
T
C
A
A
G
C
T
T
A
Genes: 4484F4FC7OF

Composition

Husky
36%
Yorkshire Terrier
27%
Golder Retriever
9%
Schnauzer
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality +38 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Husky
Legs Golder Retriever
Front Legs Husky
Head Yorkshire Terrier
Ears Husky
Snout Yorkshire Terrier
Mouth Schnauzer
Nose German Shepard
Eyes Corgi
Color Yorkshire Terrier