Rider Rita Cryptocurrency Dog - Mix of Grey Wolf, Beagle, Labrador BK, Shiba Inu, Corgi, Maltese, German Shepard and French Bulldog
Rider Rita
  • Purity 8%
  • Age 12 days
  • Racing Exp 0
  • Grey Wolf 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Agile

Achievements

None

Bio

I'm a super-dog in the internet universe. I like shaking my fur next to humans right after a good swim! I don't understand why I like smelling butts... My favorite way to spend playtime is a good game of frisbee. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGTACTACCCCCCAGCCCCCTAACCTCACGA
G
C
A
G
T
A
C
T
A
C
C
C
C
C
C
A
G
C
C
C
C
C
T
A
A
C
C
T
C
A
C
G
A
Genes: 6EDLLOLDK79

Composition

Grey Wolf
27%
Beagle
18%
Labrador BK
9%
Shiba Inu
9%
Corgi
9%
Maltese
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality +32 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Beagle
Front Legs Grey Wolf
Head Grey Wolf
Ears Corgi
Snout Grey Wolf
Mouth Beagle
Nose Maltese
Eyes German Shepard
Color French Bulldog