Chessie Cupcake Bitcoin Dog - Mix of Pug, Shiba Inu, Yorkshire Terrier, Husky and Pitbull terrier
Chessie Cupcake
  • Purity 31%
  • Age 7 months
  • Racing Exp 0
  • Pug 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I'm into chasing fast cars, squirrels and my tail. I'll eat my vomit and yours too. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I don't like going to the groomer. Leave my beautiful fur alone!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAGAAGAAGTATTAGAAGAAGAAGTAACATCC
G
A
A
G
A
A
G
A
A
G
T
A
T
T
A
G
A
A
G
A
A
G
A
A
G
T
A
A
C
A
T
C
C
Genes: 222EF222E4N

Composition

Pug
55%
Shiba Inu
18%
Yorkshire Terrier
9%
Husky
9%
Pitbull terrier
9%

Current Energy

Vitality -65 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Husky
Color Pitbull terrier

Parents

No Children

Gift