Carla Callisto Digital Cryptocurrency Game Dog - Mix of Border Collie, Grey Wolf, Golder Retriever, Shiba Inu, Beagle, Poodle and French Bulldog
Carla Callisto
  • Purity 11%
  • Age 7 months
  • Racing Exp 0
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Tardy

Achievements

None

Bio

I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm going kill that damn Nyan Cat if I can catch it. I enjoy mixing it up once in a while by visiting different dog parks.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
Rank 70  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACCCCTACCCTACTACGACTACCGAAGAAGA
G
T
A
C
C
C
C
T
A
C
C
C
T
A
C
T
A
C
G
A
C
T
A
C
C
G
A
A
G
A
A
G
A
Genes: ELDLJJIJ988

Composition

Border Collie
27%
Grey Wolf
18%
Golder Retriever
18%
Shiba Inu
9%
Beagle
9%
Poodle
9%
French Bulldog
9%

Current Energy

Vitality -25 points
Lunar Effect -10 points

Traits Breakdown

Body Shiba Inu
Tail Grey Wolf
Legs Beagle
Front Legs Grey Wolf
Head Border Collie
Ears Border Collie
Snout Poodle
Mouth Border Collie
Nose French Bulldog
Eyes Golder Retriever
Color Golder Retriever

Parents

No Children

Gift