Shelby Sindel Crypto Game Dog - Mix of Maltese, Grey Wolf, Schnauzer and French Bulldog
Shelby Sindel
  • Purity 39%
  • Age 5 months
  • Racing Exp 0
  • Maltese 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Ecstatic & Fast

Achievements

None

Bio

How you doin? ;) Shelby Sindel here. I was born in the web cloud. I never knew my father. My favorite pastime is playing tug-of-war with my human's underwear. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. I hate never catching that damn rabbit in my dreams.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCACCACCACCCCCACCATACGAACCACCACC
C
C
C
A
C
C
A
C
C
A
C
C
C
C
C
A
C
C
A
T
A
C
G
A
A
C
C
A
C
C
A
C
C
Genes: LKKKLKC9KKK

Composition

Maltese
64%
Grey Wolf
18%
Schnauzer
9%
French Bulldog
9%

Current Energy

Vitality -50 points
Lunar Effect +10 points

Traits Breakdown

Body Grey Wolf
Tail Maltese
Legs Maltese
Front Legs Maltese
Head Grey Wolf
Ears Maltese
Snout Schnauzer
Mouth French Bulldog
Nose Maltese
Eyes Maltese
Color Maltese