Brodie Bernie Crypto Dog - Mix of Beagle, Dachshund, Boxer, Golder Retriever, Border Collie, Pug and St. Bernard
Brodie Bernie
  • Purity 7%
  • Age 12 days
  • Racing Exp 0
  • Beagle 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Lazy

Achievements

None

Bio

My name is Brodie Bernie and I do tricks. I slept with a cat and I liked it. I don't like to be ignored. After introductory sniffing, I like some licking. In my humble opinion the best toy is one of my human's stinky, old socks.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAAGACTAAACTACCTAAACGGACTAGAATGA
G
G
A
A
G
A
C
T
A
A
A
C
T
A
C
C
T
A
A
A
C
G
G
A
C
T
A
G
A
A
T
G
A
Genes: A8DGJDGAD2B

Composition

Beagle
27%
Dachshund
18%
Boxer
18%
Golder Retriever
9%
Border Collie
9%
Pug
9%
St. Bernard
9%

Current Energy

Vitality +20 points
Lunar Effect -6 points

Traits Breakdown

Body Dachshund
Tail Golder Retriever
Legs Beagle
Front Legs Boxer
Head Border Collie
Ears Beagle
Snout Boxer
Mouth Dachshund
Nose Beagle
Eyes Pug
Color St. Bernard