Greta Gus Bitcoin Dog - Mix of French Bulldog, Pitbull terrier, Beagle, Corgi, St. Bernard, Golder Retriever, Shiba Inu, Labrador, Border Collie and Schnauzer
Greta Gus
  • Purity 1%
  • Age 23 days
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Sad & Tardy

Achievements

None

Bio

I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I love the smell of freshly cut grass. My human is my best friend, looking for someone who is okay with that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCCTAAGCTGAAGAGTACGACCATACCGAATA
T
C
C
C
T
A
A
G
C
T
G
A
A
G
A
G
T
A
C
G
A
C
C
A
T
A
C
C
G
A
A
T
A
Genes: NDOB8E95J9C

Composition

French Bulldog
18%
Pitbull terrier
9%
Beagle
9%
Corgi
9%
St. Bernard
9%
Golder Retriever
9%
Shiba Inu
9%
Labrador
9%
Border Collie
9%
Schnauzer
9%

Current Energy

Vitality +9 points
Lunar Effect +8 points

Traits Breakdown

Body Pitbull terrier
Tail Beagle
Legs Corgi
Front Legs St. Bernard
Head Golder Retriever
Ears Shiba Inu
Snout French Bulldog
Mouth Labrador
Nose Border Collie
Eyes French Bulldog
Color Schnauzer