Buffalo Bill Blanche Crypto Game Dog - Mix of Golder Retriever, St. Bernard, Pitbull terrier, Shiba Inu, French Bulldog, Border Collie, Rottweiler and Schnauzer
Buffalo Bill Blanche
  • Purity 6%
  • Age 9 months
  • Racing Exp 0
  • Golder Retriever 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

How's it going? I'm Buffalo Bill Blanche. As a digital dog, let me say Bob Dole did not invent the internet. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I have a crush on the Grumpy cat. You'll find me walking into my favorite pet store like I own the place. I do, don't I?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACGATACAGACACTGAAGATCCTCCTGAATA
G
T
A
C
G
A
T
A
C
A
G
A
C
A
C
T
G
A
A
G
A
T
C
C
T
C
C
T
G
A
A
T
A
Genes: E9J8HB8NNBC

Composition

Golder Retriever
18%
St. Bernard
18%
Pitbull terrier
18%
Shiba Inu
9%
French Bulldog
9%
Border Collie
9%
Rottweiler
9%
Schnauzer
9%

Current Energy

Vitality -7 points
Lunar Effect +14 points

Traits Breakdown

Body Shiba Inu
Tail French Bulldog
Legs Border Collie
Front Legs Golder Retriever
Head Rottweiler
Ears St. Bernard
Snout Golder Retriever
Mouth Pitbull terrier
Nose Pitbull terrier
Eyes St. Bernard
Color Schnauzer