Glass Joe Guile Bitcoin Dog - Mix of Golder Retriever, Poodle, Beagle, Pitbull terrier, Maltese, Shiba Inu, Dachshund and Rottweiler
Glass Joe Guile
  • Purity 11%
  • Age 7 months
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

I'm into recreational spankings and a little 'ruff' play. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I hate never catching that damn rabbit in my dreams. Dragging my butt on the carpet feels so good.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACAGACTATCCAGAACCGTAGGACACAGAAGA
G
A
C
A
G
A
C
T
A
T
C
C
A
G
A
A
C
C
G
T
A
G
G
A
C
A
C
A
G
A
A
G
A
Genes: I8DN8KEAH88

Composition

Golder Retriever
36%
Poodle
9%
Beagle
9%
Pitbull terrier
9%
Maltese
9%
Shiba Inu
9%
Dachshund
9%
Rottweiler
9%

Current Energy

Vitality -61 points
Lunar Effect -14 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs Beagle
Front Legs Pitbull terrier
Head Golder Retriever
Ears Maltese
Snout Shiba Inu
Mouth Dachshund
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever