Merlin Maui Litecoin Dog - Mix of Shiba Inu, German Shepard, Beagle, Maltese, Labrador BK, French Bulldog and Golder Retriever
Merlin Maui
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

Wassup? Yo, call me Merlin Maui. I'm a serial monogamist. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I don't like going to the groomer. Leave my beautiful fur alone! I'm always up for a nice long walk around the neighborhood.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAACCGTAGCAGTACGAGTAGTATCAAGATCA
C
T
A
A
C
C
G
T
A
G
C
A
G
T
A
C
G
A
G
T
A
G
T
A
T
C
A
A
G
A
T
C
A
Genes: DKE6E9EE787

Composition

Shiba Inu
36%
German Shepard
18%
Beagle
9%
Maltese
9%
Labrador BK
9%
French Bulldog
9%
Golder Retriever
9%

Current Energy

Vitality -31 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Shiba Inu
Front Legs Labrador BK
Head Shiba Inu
Ears French Bulldog
Snout Shiba Inu
Mouth Shiba Inu
Nose German Shepard
Eyes Golder Retriever
Color German Shepard