Copper Commando Bitcoin Dog - Mix of Corgi, St. Bernard, Boxer, Labrador BK and French Bulldog
Copper Commando
  • Purity 26%
  • Age 17 months
  • Racing Exp 0
  • Corgi 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Sad & Tardy

Achievements

None

Bio

I'm a super-dog in the internet universe. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'm always up for some puppy action, is that wrong?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCAGCAGCAGCAGCTGAAACTGAGCATGACGA
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
T
G
A
A
A
C
T
G
A
G
C
A
T
G
A
C
G
A
Genes: OOOOOBGB6B9

Composition

Corgi
45%
St. Bernard
27%
Boxer
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality -40 points
Lunar Effect +8 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears St. Bernard
Snout Boxer
Mouth St. Bernard
Nose Labrador BK
Eyes St. Bernard
Color French Bulldog

Parents

No Children

Gift