Mischief Muffin Litecoin Game Dog - Mix of Labrador BK, Yorkshire Terrier, St. Bernard, Corgi, Grey Wolf, Schnauzer, Rottweiler, Dachshund, Boxer and French Bulldog
Mischief Muffin
  • Purity 1%
  • Age 13 months
  • Racing Exp 0
  • Labrador BK 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

How you doin? ;) Mischief Muffin here. I love unconditionally. My favorite position is doggie style ;) I've had my nose rubbed in 'it' more than once. I don't like to be ignored.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTATGAGCAAGCCCCATACACGGAGCAAACCGA
T
T
A
T
G
A
G
C
A
A
G
C
C
C
C
A
T
A
C
A
C
G
G
A
G
C
A
A
A
C
C
G
A
Genes: FB6OLCHA6G9

Composition

Labrador BK
18%
Yorkshire Terrier
9%
St. Bernard
9%
Corgi
9%
Grey Wolf
9%
Schnauzer
9%
Rottweiler
9%
Dachshund
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail St. Bernard
Legs Labrador BK
Front Legs Corgi
Head Grey Wolf
Ears Schnauzer
Snout Rottweiler
Mouth Dachshund
Nose Labrador BK
Eyes Boxer
Color French Bulldog

Parents

No Children

Gift