Macintosh Madeline Digital Cryptocurrency Game Dog - Mix of French Bulldog, Corgi, Golder Retriever, Shiba Inu, German Shepard and Border Collie
Macintosh Madeline
  • Purity 27%
  • Age 3 months
  • Racing Exp 0
  • French Bulldog 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

How do you do? I'm Macintosh Madeline. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I absolutely love long walks when I can stop and smell the bushes. I'm always up for a nice long walk around the neighborhood. I want to find a mate who enjoys dog parks as much as I do.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCCGACGACGAAGAGTACGATCATACCGACGA
A
G
C
C
G
A
C
G
A
C
G
A
A
G
A
G
T
A
C
G
A
T
C
A
T
A
C
C
G
A
C
G
A
Genes: O9998E97J99

Composition

French Bulldog
55%
Corgi
9%
Golder Retriever
9%
Shiba Inu
9%
German Shepard
9%
Border Collie
9%

Current Energy

Vitality -24 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head Golder Retriever
Ears Shiba Inu
Snout French Bulldog
Mouth German Shepard
Nose Border Collie
Eyes French Bulldog
Color French Bulldog