Troy Tuesday Litecoin Dog - Mix of French Bulldog, Corgi, Grey Wolf, Golder Retriever, Labrador BK, St. Bernard, German Shepard and Shiba Inu
Troy Tuesday
  • Purity 11%
  • Age 5 months
  • Racing Exp 0
  • French Bulldog 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

Hello, I be Troy Tuesday. I am not above stealing food off humans' plates. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCCGACCCCGAAGAGCATGATCAGTACGACGA
A
G
C
C
G
A
C
C
C
C
G
A
A
G
A
G
C
A
T
G
A
T
C
A
G
T
A
C
G
A
C
G
A
Genes: O9L986B7E99

Composition

French Bulldog
36%
Corgi
9%
Grey Wolf
9%
Golder Retriever
9%
Labrador BK
9%
St. Bernard
9%
German Shepard
9%
Shiba Inu
9%

Current Energy

Vitality -38 points
Lunar Effect +4 points

Traits Breakdown

Body Corgi
Tail French Bulldog
Legs Grey Wolf
Front Legs French Bulldog
Head Golder Retriever
Ears Labrador BK
Snout St. Bernard
Mouth German Shepard
Nose Shiba Inu
Eyes French Bulldog
Color French Bulldog