Gridiron Goose Bitcoin Game Dog - Mix of French Bulldog, St. Bernard, Corgi, Grey Wolf, Maltese, Labrador BK, Pug and Shiba Inu
Gridiron Goose
  • Purity 8%
  • Age 8 months
  • Racing Exp 0
  • French Bulldog 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

I'm Gridiron Goose. How goes it? The cloud's my neighborhood. I'm the best at running circle 8's. Halloween costumes are the worst, I hate 'em! I have a crush on the Grumpy cat. My favorite place to sleep is under the covers between my humans. I'm looking for a hard-working service animal who can keep up with me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCCGACCCTGAACCGCATGAGAAGTACGACGA
A
G
C
C
G
A
C
C
C
T
G
A
A
C
C
G
C
A
T
G
A
G
A
A
G
T
A
C
G
A
C
G
A
Genes: O9LBK6B2E99

Composition

French Bulldog
27%
St. Bernard
18%
Corgi
9%
Grey Wolf
9%
Maltese
9%
Labrador BK
9%
Pug
9%
Shiba Inu
9%

Current Energy

Vitality -32 points
Lunar Effect -2 points

Traits Breakdown

Body Corgi
Tail French Bulldog
Legs Grey Wolf
Front Legs St. Bernard
Head Maltese
Ears Labrador BK
Snout St. Bernard
Mouth Pug
Nose Shiba Inu
Eyes French Bulldog
Color French Bulldog