Sparkle Sable Crypto Dog - Mix of French Bulldog, Labrador, Husky, Golder Retriever, Maltese, Corgi and Shiba Inu
Sparkle Sable
  • Purity 11%
  • Age 4 months
  • Racing Exp 8
  • French Bulldog 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Who's a good dog? Hopefully you! Sparkle Sable here. Even living on the internet like I do, too much kibble makes my bandwidth expand. I'm into chasing fast cars, squirrels and my tail. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time15.18 sec
No rank  RacingĀ *** LTC
33.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACACGACCAAGACCAACCCGACGAAGCGTACCA
A
C
A
C
G
A
C
C
A
A
G
A
C
C
A
A
C
C
C
G
A
C
G
A
A
G
C
G
T
A
C
C
A
Genes: 49585K99OE5

Composition

French Bulldog
27%
Labrador
27%
Husky
9%
Golder Retriever
9%
Maltese
9%
Corgi
9%
Shiba Inu
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Labrador
Front Legs Golder Retriever
Head Labrador
Ears Maltese
Snout French Bulldog
Mouth French Bulldog
Nose Corgi
Eyes Shiba Inu
Color Labrador

Parents

No Children

Photos

online dog racing podium
Gift