Emmett Epona Litecoin Game Dog - Mix of Corgi, Pitbull terrier, Labrador, Rottweiler, Maltese and St. Bernard
Emmett Epona
  • Purity 12%
  • Age 8 months
  • Racing Exp 8
  • Corgi 27%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

As a digital dog, let me say Bob Dole did not invent the internet. My favorite sport is catching treats my human throws! I've always wanted to be in commercials and be treated as the star I am! I want someone who can show me a good time; I'll do the same for you.

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time15.10 sec
Rank 48  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCAGCAGCCCAACCCACCACCCATCCAGCTGA
T
C
C
A
G
C
A
G
C
C
C
A
A
C
C
C
A
C
C
A
C
C
C
A
T
C
C
A
G
C
T
G
A
Genes: NOO5KHH5NOB

Composition

Corgi
27%
Pitbull terrier
18%
Labrador
18%
Rottweiler
18%
Maltese
9%
St. Bernard
9%

Current Energy

Vitality -33 points
Lunar Effect +8 points

Traits Breakdown

Body Pitbull terrier
Tail Corgi
Legs Corgi
Front Legs Labrador
Head Maltese
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Pitbull terrier
Eyes Corgi
Color St. Bernard