Snowflake Scruffy Crypto Dog - Pure Border Collie
Snowflake Scruffy
  • Purity 100%
  • Age 5 months
  • Racing Exp 0
  • Border Collie 100%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Depressed & Snaillike

Achievements

First Pure Breed Dog

Bio

Suh? How's it goin? I'm Snowflake Scruffy. Those flying monkeys in the Wizard of Oz still scare me! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! You know the worst? Watching my humans 'get it on' when I've got no one.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACTAC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
Genes: JJJJJJJJJJJ

Composition

Border Collie
100%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred Border Collie