Ruffles Rascal Bitcoin Dog - Mix of Border Collie and Rottweiler
Ruffles Rascal
  • Purity 82%
  • Age 60 days
  • Racing Exp 23
  • Border Collie 91%
  • Gold medal 2 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 4
Sad & Snaillike

Achievements

Racer

Bio

Too much steak gives me the runs! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! My turn-offs are rolled up newspapers and loud noises. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized.

Racing Stats

Ran 3 races
  • 2 1 0
 Best Time14.00 sec
No rank  RacingĀ *** LTC
100.0 % wins (3) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACCAC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
C
A
C
Genes: JJJJJJJJJJH

Composition

Border Collie
91%
Rottweiler
9%

Current Energy

Vitality +37 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Border Collie
Color Rottweiler