Mila Misty Digital Cryptocurrency Dog - Mix of Pug, French Bulldog, Husky, Labrador, Grey Wolf, Shiba Inu, Border Collie, Labrador BK, Poodle and St. Bernard
Mila Misty
  • Purity 1%
  • Age 19 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

I live in cyberspace. I live life by my favorite quote "Every dog has it's day", but every day is my day! Forget plastic hotdogs...I'm into the classic chew toys like slippers. My turn-offs are rolled up newspapers and loud noises. My 'G' spot is under my chin...scratch me there and I'll growl softly.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAGAAACACCACCCGTATACGAAGCAGACTGA
C
G
A
G
A
A
A
C
A
C
C
A
C
C
C
G
T
A
T
A
C
G
A
A
G
C
A
G
A
C
T
G
A
Genes: 9245LEJ26IB

Composition

Pug
18%
French Bulldog
9%
Husky
9%
Labrador
9%
Grey Wolf
9%
Shiba Inu
9%
Border Collie
9%
Labrador BK
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -18 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail Pug
Legs Husky
Front Legs Labrador
Head Grey Wolf
Ears Shiba Inu
Snout Border Collie
Mouth Pug
Nose Labrador BK
Eyes Poodle
Color St. Bernard

Parents

No Children

Gift