Adelaide Alvin Digital Cryptocurrency Dog - Mix of Border Collie, Husky, Rottweiler, Corgi and St. Bernard
Adelaide Alvin
  • Purity 38%
  • Age 3 months
  • Racing Exp 0
  • Border Collie 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

I'm Adelaide Alvin and I'd like to show you a trick or two. I like to respond to sad puppy eyes with sad puppy eyes of my own. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACTACACATACTACCACTACTACAGCTGA
T
A
C
T
A
C
T
A
C
A
C
A
T
A
C
T
A
C
C
A
C
T
A
C
T
A
C
A
G
C
T
G
A
Genes: JJJ4JJHJJOB

Composition

Border Collie
64%
Husky
9%
Rottweiler
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -1 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Husky
Head Border Collie
Ears Border Collie
Snout Rottweiler
Mouth Border Collie
Nose Border Collie
Eyes Corgi
Color St. Bernard